From 68da51f887afb13aec2f22000997a977b299cdb4 Mon Sep 17 00:00:00 2001 From: Andrew D Smith Date: Fri, 27 Feb 2026 17:42:51 -0800 Subject: [PATCH] Multiple sources: removing using statements ahead of adding static analysis ci --- src/FalcoConfig.cpp | 129 ++-- src/FastqStats.cpp | 45 +- src/HtmlMaker.cpp | 42 +- src/Module.cpp | 1333 +++++++++++++++++++++--------------------- src/Module.hpp | 386 ++++++------ src/StreamReader.cpp | 350 +++++------ src/falco.cpp | 46 +- src/falcodiff.cpp | 204 +++---- 8 files changed, 1243 insertions(+), 1292 deletions(-) diff --git a/src/FalcoConfig.cpp b/src/FalcoConfig.cpp index 8f3164f..5df3556 100644 --- a/src/FalcoConfig.cpp +++ b/src/FalcoConfig.cpp @@ -16,26 +16,15 @@ #include "FalcoConfig.hpp" #include "FastqStats.hpp" -#include -#include #include #include + +#include +#include #include #include -using std::ostringstream; -using std::transform; -using std::string; -using std::vector; -using std::unordered_map; -using std::pair; -using std::make_pair; -using std::ifstream; -using std::runtime_error; -using std::istringstream; -using std::cerr; - -const string FalcoConfig::FalcoVersion = "1.2.5"; +const std::string FalcoConfig::FalcoVersion = "1.2.5"; /*********************************************************/ /************** DEFAULT VALUES FOR FILES *****************/ @@ -44,7 +33,7 @@ const string FalcoConfig::FalcoVersion = "1.2.5"; namespace FileConstants { // These will become const bools in the stream reader static const std::unordered_map > + std::unordered_map> limits = { {"quality_base",{{"ignore",0}}}, {"duplication",{{"ignore",0}, {"warn",70}, {"error",50}}}, @@ -62,7 +51,7 @@ namespace FileConstants { }; /*************** CONTAMINANTS *****************/ - static const std::vector > + static const std::vector> contaminants = { {"Illumina Single End Adapter 1","GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG"}, {"Illumina Single End Adapter 2","CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT"}, @@ -254,7 +243,7 @@ namespace FileConstants { // Check if line is not a comment or newline inline bool -is_content_line (const string &line) { +is_content_line (const std::string &line) { // comment if (line[0] == '#') return false; @@ -269,7 +258,7 @@ is_content_line (const string &line) { // Check existance of config files inline bool file_exists(const std::string& name) { - return (access(name.c_str(), F_OK) == 0); + return access(std::data(name), F_OK) == 0; } @@ -279,7 +268,7 @@ file_exists(const std::string& name) { // variable, and files are not read properly // if these bytes are not removed void -clean_zero_bytes(string &filename) { +clean_zero_bytes(std::string &filename) { filename.erase(std::remove(begin(filename), end(filename), '\0'), end(filename)); } @@ -294,10 +283,10 @@ endswith(std::string const &value, std::string const &ending) { } // Removes absolute path from a file -static string -strip_path(string full_path) { +static std::string +strip_path(std::string full_path) { size_t start = full_path.find_last_of('/'); - if (start == string::npos) + if (start == std::string::npos) start = 0; else ++start; @@ -319,9 +308,9 @@ FalcoConfig::FalcoConfig(const int argc, char *argv[]) { read_step = 1; format = ""; threads = 1; - contaminants_file = string(PROGRAM_PATH) + "/Configuration/contaminant_list.txt"; - adapters_file = string(PROGRAM_PATH) + "/Configuration/adapter_list.txt"; - limits_file = string(PROGRAM_PATH) + "/Configuration/limits.txt"; + contaminants_file = std::string(PROGRAM_PATH) + "/Configuration/contaminant_list.txt"; + adapters_file = std::string(PROGRAM_PATH) + "/Configuration/adapter_list.txt"; + limits_file = std::string(PROGRAM_PATH) + "/Configuration/limits.txt"; clean_zero_bytes(contaminants_file); clean_zero_bytes(adapters_file); @@ -337,16 +326,16 @@ FalcoConfig::FalcoConfig(const int argc, char *argv[]) { is_fastq = false; is_fastq_gz = false; - ostringstream ost; + std::ostringstream ost; for (int i = 0; i < argc; ++i) { if (i != 0) ost << " " ; - ost << string(argv[i]); + ost << std::string(argv[i]); } call = ost.str(); } -const vector FalcoConfig::values_to_check({ +const std::vector FalcoConfig::values_to_check({ "duplication", "kmer", "n_content", @@ -375,13 +364,13 @@ const vector FalcoConfig::values_to_check({ template bool check_if_not_ignored(const T& limits_map, - const string &limit) { + const std::string &limit) { if (limits_map.find(limit) == end(limits_map)) - throw runtime_error("no instructions for limit " + limit); + throw std::runtime_error("no instructions for limit " + limit); const auto the_limit = limits_map.find(limit)->second; if (the_limit.find("ignore") == end(the_limit)) - throw runtime_error("'ignore' option not set for limit " + limit); + throw std::runtime_error("'ignore' option not set for limit " + limit); const bool ret = (the_limit.find("ignore")->second == 0.0); @@ -406,9 +395,9 @@ FalcoConfig::setup() { void FalcoConfig::define_file_format() { - transform(begin(format), end(format), begin(format), tolower); - string tmp_filename = filename; - transform(begin(tmp_filename), end(tmp_filename), begin(tmp_filename), tolower); + std::transform(begin(format), end(format), begin(format), tolower); + std::string tmp_filename = filename; + std::transform(begin(tmp_filename), end(tmp_filename), begin(tmp_filename), tolower); // reset, important bececause the same FalcoConfig object is used // across possibly multiple input files @@ -444,7 +433,7 @@ FalcoConfig::define_file_format() { #endif else if (format == "fq.gz" || format == "fastq.gz") is_fastq_gz = true; else if (format == "fq" || format == "fastq") is_fastq = true; - else throw runtime_error("unrecognized file format: " + format); + else throw std::runtime_error("unrecognized file format: " + format); } } @@ -454,38 +443,38 @@ FalcoConfig::read_limits() { limits = FileConstants::limits; if (!file_exists(limits_file)) { if (!quiet) - cerr << "[limits]\tWARNING: using default limits because " + std::cerr << "[limits]\tWARNING: using default limits because " << "limits file does not exist: " << limits_file << "\n"; } else { - ifstream in(limits_file); + std::ifstream in(limits_file); if (!in) - throw runtime_error("problem opening limits file: " + limits_file); + throw std::runtime_error("problem opening limits file: " + limits_file); if (!quiet) - cerr << "[limits]\tusing file " << limits_file << "\n"; + std::cerr << "[limits]\tusing file " << limits_file << "\n"; // Variables to parse lines - string line, instruction; + std::string line, instruction; double value; while (getline(in, line)) { // Checks if the line has something to be parsed if (is_content_line(line)) { - istringstream iss(line); + std::istringstream iss(line); // Every line is a limit, warn/error/ignore and the value - string limit; + std::string limit; if (!(iss >> limit >> instruction >> value)) - throw runtime_error("malformed limits line: \"" + line + "\""); + throw std::runtime_error("malformed limits line: \"" + line + "\""); if (find(begin(values_to_check), end(values_to_check), limit) == end(values_to_check)) - throw runtime_error("unknown limit option: " + limit); + throw std::runtime_error("unknown limit option: " + limit); if (instruction != "warn" && instruction != "error" && instruction != "ignore") - throw runtime_error("unknown instruction for limit " + + throw std::runtime_error("unknown instruction for limit " + limit + ": " + instruction); limits[limit][instruction] = value; @@ -511,11 +500,11 @@ FalcoConfig::read_limits() { } size_t -hash_adapter(const string &s) { +hash_adapter(const std::string &s) { size_t ans = 0; for (size_t i = 0; i < s.size(); ++i) { if (s[i] != 'A' && s[i] != 'C' && s[i] != 'T' && s[i] != 'G') - throw runtime_error("Bad adapter (non-ATGC characters): " + s); + throw std::runtime_error("Bad adapter (non-ATGC characters): " + s); ans = (ans << 2) | actg_to_2bit(s[i]); } @@ -527,7 +516,7 @@ void FalcoConfig::read_adapters() { if (!file_exists(adapters_file)) { if (!quiet) - cerr << "[adapters]\tWARNING: using default adapters because " + std::cerr << "[adapters]\tWARNING: using default adapters because " << "adapters file does not exist: " << adapters_file << "\n"; adapter_names = FileConstants::adapter_names; @@ -541,16 +530,16 @@ FalcoConfig::read_adapters() { return; } - ifstream in(adapters_file); + std::ifstream in(adapters_file); if (!in) - throw runtime_error("problem opening adapters file: " + adapters_file); + throw std::runtime_error("problem opening adapters file: " + adapters_file); if (!quiet) - cerr << "[adapters]\tusing file " << adapters_file << "\n"; + std::cerr << "[adapters]\tusing file " << adapters_file << "\n"; - string line, _tmp; - vector line_by_space; - string adapter_name, adapter_seq; + std::string line, _tmp; + std::vector line_by_space; + std::string adapter_name, adapter_seq; // The adapters file has a space separated name, and the last instance is // the biological sequence @@ -565,14 +554,14 @@ FalcoConfig::read_adapters() { if (is_content_line(line)) { if (adapter_names.size() > Constants::max_adapters) { in.close(); - throw runtime_error("You are testing too many adapters. The maximum " + throw std::runtime_error("You are testing too many adapters. The maximum " "number is 128!"); } adapter_name = ""; adapter_seq = ""; line_by_space.clear(); - istringstream iss(line); + std::istringstream iss(line); while (iss >> _tmp) { line_by_space.push_back(_tmp); } @@ -585,7 +574,7 @@ FalcoConfig::read_adapters() { adapter_seq = line_by_space.back(); if (adapter_seq.size() > 32) { - cerr << "[adapters]\tadapter size is more then 32. Use slow adapters search" << "\n"; + std::cerr << "[adapters]\tadapter size is more then 32. Use slow adapters search\n"; do_adapter_optimized = false; } } @@ -600,7 +589,7 @@ FalcoConfig::read_adapters() { shortest_adapter_size = adapter_size; } else if (adapter_seq.size() != adapter_size) { - cerr << "[adapters]\tadapters have different size. Use slow adapters search" << "\n"; + std::cerr << "[adapters]\tadapters have different size. Use slow adapters search\n"; do_adapter_optimized = false; if(adapter_seq.size() < shortest_adapter_size){ shortest_adapter_size = adapter_seq.size(); @@ -615,35 +604,35 @@ void FalcoConfig::read_contaminants_file() { if (!file_exists(contaminants_file)) { if (!quiet) - cerr << "[contaminants]\tWARNING: using default contaminants because " + std::cerr << "[contaminants]\tWARNING: using default contaminants because " << "contaminants file does not exist: " << contaminants_file << "\n"; contaminants = FileConstants::contaminants; return; } - ifstream in(contaminants_file); + std::ifstream in(contaminants_file); if (!in) - throw runtime_error("problem opening contaminants file: " + contaminants_file); + throw std::runtime_error("problem opening contaminants file: " + contaminants_file); if (!quiet) - cerr << "[contaminants]\tusing file " << contaminants_file << "\n"; - vector line_by_space; + std::cerr << "[contaminants]\tusing file " << contaminants_file << "\n"; + std::vector line_by_space; // The contaminants file has a space separated name, and the last // instance is the biological sequence - string line; + std::string line; contaminants.clear(); while (getline(in, line)) { if (is_content_line(line)) { - istringstream iss(line); - string token; + std::istringstream iss(line); + std::string token; while (iss >> token) line_by_space.push_back(token); if (line_by_space.size() > 1) { - string contaminant_name = line_by_space[0]; + std::string contaminant_name = line_by_space[0]; for (size_t i = 1; i < line_by_space.size() - 1; ++i) contaminant_name += " " + line_by_space[i]; - contaminants.push_back(make_pair(contaminant_name, line_by_space.back())); + contaminants.push_back(std::make_pair(contaminant_name, line_by_space.back())); } line_by_space.clear(); } @@ -651,7 +640,7 @@ FalcoConfig::read_contaminants_file() { in.close(); } -const string FalcoConfig::html_template = +const std::string FalcoConfig::html_template = "" "" " " diff --git a/src/FastqStats.cpp b/src/FastqStats.cpp index 4cf5b14..ec9125f 100644 --- a/src/FastqStats.cpp +++ b/src/FastqStats.cpp @@ -16,20 +16,8 @@ #include "FastqStats.hpp" #include -#include #include -using std::string; -using std::vector; -using std::array; -using std::unordered_map; -using std::sort; -using std::min; -using std::max; -using std::ostream; -using std::pair; -using std::transform; -using std::toupper; -using std::setprecision; +#include // ADS: Defining const static integer class variables here for // correctness. Optimizer has been ignoring the issue. Hopefully it @@ -47,9 +35,9 @@ const size_t FastqStats::kBitShiftQuality; const size_t FastqStats::kBitShiftAdapter; // To make the gc models static const -static array -make_gc_models () { - array ans; +static std::array +make_gc_models() { + std::array ans; for (size_t i = 0; i < FastqStats::SHORT_READ_THRESHOLD; ++i) { ans[i] = GCModel(i); } @@ -85,12 +73,13 @@ FastqStats::FastqStats() { position_quality_count.fill(0); pos_kmer_count.fill(0); pos_adapter_count.fill(0); - kmer_count = vector(SHORT_READ_THRESHOLD*(Constants::kmer_mask + 1), 0); + kmer_count = + std::vector(SHORT_READ_THRESHOLD * (Constants::kmer_mask + 1), 0); } // Initialize as many gc models as fast bases -const array -FastqStats::gc_models = make_gc_models(); +const std::array + FastqStats::gc_models = make_gc_models(); // When we read new bases, dynamically allocate new space for their statistics void @@ -110,10 +99,10 @@ FastqStats::allocate_new_base(const bool ignore_tile) { // space for tile quality in each position. // if (!ignore_tile) { - for (auto &v : tile_position_quality) { + for (auto &v : tile_position_quality) { v.second.push_back(0); } - for (auto &v : tile_position_count) { + for (auto &v : tile_position_count) { v.second.push_back(0); } } @@ -154,16 +143,14 @@ FastqStats::summarize() { } } - void FastqStats::adjust_tile_maps_len() { - for (auto it = begin(tile_position_quality); - it != end(tile_position_quality); it++) { - it->second.resize(max_read_length); // Always increase space + for (auto it = begin(tile_position_quality); it != end(tile_position_quality); + it++) { + it->second.resize(max_read_length); // Always increase space } - for (auto it = begin(tile_position_count); - it != end(tile_position_count); it++) { - it->second.resize(max_read_length); // Always increase space + for (auto it = begin(tile_position_count); it != end(tile_position_count); + it++) { + it->second.resize(max_read_length); // Always increase space } } - diff --git a/src/HtmlMaker.cpp b/src/HtmlMaker.cpp index 4767de2..3652ac0 100644 --- a/src/HtmlMaker.cpp +++ b/src/HtmlMaker.cpp @@ -14,33 +14,21 @@ */ #include "HtmlMaker.hpp" + #include -#include #include #include -#include - -using std::ostringstream; -using std::string; -using std::vector; -using std::sort; -using std::ifstream; -using std::runtime_error; -using std::chrono::system_clock; -using std::min; - +#include void -HtmlMaker::put_data(const string &placeholder, - const string &data) { +HtmlMaker::put_data(const std::string &placeholder, const std::string &data) { auto pos = html_boilerplate.find(placeholder); // Placeholder not found - if (pos == string::npos) { - throw runtime_error("placeholder not found: " + placeholder); - } + if (pos == std::string::npos) + throw std::runtime_error("placeholder not found: " + placeholder); // at least one placeholder found - while (pos != string::npos) { + while (pos != std::string::npos) { html_boilerplate.replace(pos, placeholder.size(), data); pos = html_boilerplate.find(placeholder, pos + 1); } @@ -48,9 +36,8 @@ HtmlMaker::put_data(const string &placeholder, // Comments out html pieces if analyses were skipped void -HtmlMaker::put_comment(string &comment_begin, - string &comment_end, - bool done) { +HtmlMaker::put_comment(std::string &comment_begin, std::string &comment_end, + bool done) { // put html comments if analysis was skipped if (!done) { put_data(comment_begin, "