Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
152 changes: 127 additions & 25 deletions gene_finder.py
Original file line number Diff line number Diff line change
@@ -1,16 +1,15 @@
# -*- coding: utf-8 -*-
"""
YOUR HEADER COMMENT HERE
First project for Olin Software Design Fall 2017
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

It might be more helpful to add some short description of what this project is about.


@author: YOUR NAME HERE
@author: Emma Westerhoff

"""

import random
from amino_acids import aa, codons, aa_table # you may find these useful
from load import load_seq


def shuffle_string(s):
"""Shuffles the characters in the input string
NOTE: this is a helper function, you do not
Expand All @@ -30,9 +29,15 @@ def get_complement(nucleotide):
>>> get_complement('C')
'G'
"""
# TODO: implement this
pass

nucleotide_inputs = ['A', 'T', 'C', 'G']
nucleotide_complements = ['T', 'A', 'G', 'C']
i = 0
complement = 'x' #lets the user know the complement was incorrectly computed
while i < len(nucleotide_inputs):
if nucleotide_inputs[i] == nucleotide:
complement = nucleotide_complements[i]
i += 1
return complement
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I like how you implemented this function without using any if or else if statements. Now that you've learned what dictionaries are, you could do something like this as well :
nucleotide_complements' = {'A':'T', 'T':'C', 'C':'G', 'G':'C'}
return nucleotide_complements[nucleotide]


def get_reverse_complement(dna):
""" Computes the reverse complementary sequence of DNA for the specfied DNA
Expand All @@ -45,9 +50,16 @@ def get_reverse_complement(dna):
>>> get_reverse_complement("CCGCGTTCA")
'TGAACGCGG'
"""
# TODO: implement this
pass
reverse = ''
i = 0
length = len(dna)

while i < length:
letter = dna[length - 1 -i] #moves backwards along the string
pair = get_complement(letter) #finds complement
reverse = reverse + pair
i += 1
return reverse
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

fancy one line code (pythonic stylistic suggestion) :
return [get_complement(c) for c in dna[::-1]]


def rest_of_ORF(dna):
""" Takes a DNA sequence that is assumed to begin with a start
Expand All @@ -61,10 +73,25 @@ def rest_of_ORF(dna):
'ATG'
>>> rest_of_ORF("ATGAGATAGG")
'ATGAGA'
>>> rest_of_ORF("ATTTCGGGT")
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Nice! Always add your own unit tests 👍

'ATTTCGGGT'
"""
# TODO: implement this
pass
stop_codons = ['TAG', 'TGA', 'TAA']
codons = []
n = 3

for i in range(0, len(dna), n):
codons.append(dna[i:i+n])

for c in range(0, len(codons)):
for s in range(0, len(stop_codons)):
if codons[c] == stop_codons[s]:
codons = codons[:c]
return_string = ''.join(codons)
return return_string

return_string = ''.join(codons)
return return_string

def find_all_ORFs_oneframe(dna):
""" Finds all non-nested open reading frames in the given DNA
Expand All @@ -79,8 +106,23 @@ def find_all_ORFs_oneframe(dna):
>>> find_all_ORFs_oneframe("ATGCATGAATGTAGATAGATGTGCCC")
['ATGCATGAATGTAGA', 'ATGTGCCC']
"""
# TODO: implement this
pass
start_codon = 'ATG'
codons = []
n = 3
ORFS = []
c = 0

for i in range(0, len(dna), n):
codons.append(dna[i:i+n])

while c in range(0, len(codons)):
if codons[c] == start_codon:
dna_sequence = rest_of_ORF(''.join(codons[c:]))
ORFS.append(dna_sequence)
c += len(dna_sequence) #skips over the rest of the sequence
c += 1 #if I'm missing a permutation, this might be a problem.

return ORFS


def find_all_ORFs(dna):
Expand All @@ -96,9 +138,16 @@ def find_all_ORFs(dna):
>>> find_all_ORFs("ATGCATGAATGTAG")
['ATGCATGAATGTAG', 'ATGAATGTAG', 'ATG']
"""
# TODO: implement this
pass
return_list = []

for i in range (0,3):
#cases are coming through that occur in the same frame
orfs = find_all_ORFs_oneframe(dna[i:])
for o in orfs:
result = ''.join(o)
if result != '': #if there are no permutations in a run through
return_list.append(result)
return return_list

def find_all_ORFs_both_strands(dna):
""" Finds all non-nested open reading frames in the given DNA sequence on both
Expand All @@ -109,19 +158,37 @@ def find_all_ORFs_both_strands(dna):
>>> find_all_ORFs_both_strands("ATGCGAATGTAGCATCAAA")
['ATGCGAATG', 'ATGCTACATTCGCAT']
"""
# TODO: implement this
pass
return_list = []

all_orfs_one = find_all_ORFs(dna)
all_orfs_two = find_all_ORFs(get_reverse_complement(dna))

for o in all_orfs_one:
return_list.append(o)

for a in all_orfs_two:
return_list.append(a)
#print(return_list)
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

please remove commented lines when submitting your final code

return return_list

def longest_ORF(dna):
""" Finds the longest ORF on both strands of the specified DNA and returns it
as a string
>>> longest_ORF("ATGCGAATGTAGCATCAAA")
'ATGCTACATTCGCAT'
"""
# TODO: implement this
pass
orfs = find_all_ORFs_both_strands(dna)

#longest_size=len(max(orfs,key=len))
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

remove comment


longest_length = 0

for o in orfs:
if len(o) > longest_length:
longest_seq = o
longest_length = len(o)

return longest_seq

def longest_ORF_noncoding(dna, num_trials):
""" Computes the maximum length of the longest ORF over num_trials shuffles
Expand All @@ -130,8 +197,17 @@ def longest_ORF_noncoding(dna, num_trials):
dna: a DNA sequence
num_trials: the number of random shuffles
returns: the maximum length longest ORF """
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

One way to add unit tests for random functions is to use a fixed random seed. Check this documentation https://docs.python.org/3/library/random.html if this sounds interesting to you.

# TODO: implement this
pass
lengths = []
max_length = 0
for rand in range(0, num_trials):
new_sequence = shuffle_string(dna)
leng = len(longest_ORF(new_sequence))
if(leng > max_length):
max_length = leng

# maximum = max(lengths)
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

remove comment

print(max_length)
return max_length


def coding_strand_to_AA(dna):
Expand All @@ -148,8 +224,21 @@ def coding_strand_to_AA(dna):
>>> coding_strand_to_AA("ATGCCCGCTTT")
'MPA'
"""
# TODO: implement this
pass
n = 3
codons = []
acids = ''

for i in range(0, len(dna), n):
codons.append(dna[i:i+n])

if len(codons[-1]) < 3:
codons.pop(-1)

for c in codons:
amino = aa_table[c]
acids += ''.join(amino)

return acids


def gene_finder(dna):
Expand All @@ -158,9 +247,22 @@ def gene_finder(dna):
dna: a DNA sequence
returns: a list of all amino acid sequences coded by the sequence dna.
"""
# TODO: implement this
pass
threshold = longest_ORF_noncoding(dna, 400)
#change this to 1500 or so later
dna_orfs = find_all_ORFs_both_strands(dna)
amino_sequences = []
longs = []

for snip in dna_orfs:
if len(snip) > threshold:
amino_sequences.append(coding_strand_to_AA(snip))

print(amino_sequences)
#print(len(amino_sequences))
Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

remove comment

return amino_sequences

if __name__ == "__main__":
import doctest
doctest.testmod()
#doctest.run_docstring_examples(coding_strand_to_AA, globals(), verbose=True)
dna = load_seq("./data/X73525.fa")
gene_finder(dna)
54 changes: 54 additions & 0 deletions nitrogenase_finder.py
Original file line number Diff line number Diff line change
@@ -0,0 +1,54 @@
"""
Extension on first project for Olin Software Design Fall 2017

@author: Emma Westerhoff

"""

Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

nice! I like the fact that you've learned the concept of dynamic programming. Something to think about : Now that you've learned about recursion, what would be the pros and cons of using recursion vs dynamic programming to tackle this problem?

from load import load_nitrogenase_seq, load_metagenome

def longest_common_substring(string1, string2): #s length r, t ength n
""" Computes the longest common substring using dynamic programming

>>> longest_common_substring('abcdefgqwertyuiop', 'xyabcdjipqwertyuiop')
'gqwertyuiop'
"""

x = len(string1)
y = len(string2)

L = [[None]*(y) for a in range(x)]

z = 0
ret = ''

for i in range(0, x):
for j in range(0, y):
if string1[i] == string2[j]:
if i == 0 or j == 0:
L[i][j] = 0
else:
L[i][j] = L[i-1][j-1] + 1
if L[i][j] > z:
z = L[i][j]
ret = string1[i-z:i+1]
#elif L[i][j] == z:
#ret.append(string1[i-z:i+1])
else:
L[i][j] = 0
return ret

def nitrogen_fixation(x):
#TODO: implement this
pass

if __name__ == "__main__":
nitrogenase = load_nitrogenase_seq()
metagenome = load_metagenome()
#metagenome is of form [('some info', 'actual sequence')]
#transform metagenome to proper form

#import doctest
#doctest.run_docstring_examples(longest_common_substring, globals(), verbose=True)
#longest = longest_common_substring(nitrogenase, metagenome)
#print(longest)